First Report of Bougainvillea chlorotic vein-banding virus Causing Chlorosis and Vein Banding of Bougainvillea spectabilis in Malaysia

Abstract

In the tropics and subtropics, various ornamental plants have been cultivated for landscape decorations. The Bougainvillea species, a perennial flowering plant, is widely grown throughout Malaysia. Its beautiful floral colours made it a popular plant in the country, even dubbed the symbol flower for Ipoh, one of the major cities in Malaysia. In November 2018, disease symptoms including foliar chlorosis, vein-banding, and mottling were observed on bougainvillea plants growing in several residential colleges in the National University of Malaysia. Suspecting infection by a virus, samples from six different symptomatic plants were examined by transmission electron microscopy (TEM) after negative staining by uranyl acetate (Baranwal et al. 2010). Typical bacilliform virions of 120-150 nm x 25-35 nm in length were found randomly scattered in the cytoplasm of the phloem tissue of leaf veins of all the samples from the six plants. To confirm the identity of the virus, viral DNA was extracted from leaves of twelve different symptomatic plants, including the six examined by TEM, using modified CTAB method (Doyle & Doyle. 1987), and then subjected to polymerase chain reaction (PCR) amplification using a primer pair specific to Bougainvillea chlorotic vein-banding virus (BCVBV) (F: 5’–ACAGCGATTTCATTGCTGTG–3’ and R: 5’–GACTAGTTCTCGATCAGAAGG–3’) (Tsai et al. 2008). Thermal cycling conditions were as follows: initial denaturation at 95℃ for 3 min; 40 cycles of 30 s at 95℃, 30 s at 58℃, and 1 min at 72℃, followed by a final extension 10 min at 72℃. Amplicons of the expected size of 395-bp were generated by PCR from all twelve samples and sequenced. All the amplicons shared 100% nucleotide identity, and one sequence was submitted to GenBank (Accession No: MK501794). BLASTn analysis showed that this virus shared a 100% nucleotide identity with a BCVBV isolated from Taiwan (DQ103759). No PCR product was obtained using extracts from leaves of ten different asymptomatic plants, confirming the absence of BCVBV. To obtain the complete sequence of the virus, total RNA from a symptomatic plant was extracted using the QIAGEN RNeasy Plant Mini Kit. The extract was subjected to library preparation using TruSeq-stranded Total RNA sample preparation Ribo-Zero plant kit (Illumina) and was treated to quality control. The library was then sent to sequencing using the HiSeq 2500 platform with a TruSeq SBS version 4 kit (Illumina) with 150 cycles of paired-end reads. Reads were then assembled de novo using Trinity version 2.8.4 (Haas et al. 2013). Subsequent MegaBLAST analysis against the NCBI virus database was then performed on the assembled transcripts, identifying one complete BCVBV genome. The contig was found to share 98.52% nucleotide sequence homology to the only complete genome available of BCVBV isolate Taiwan (EU034539.1). The revealed genome was deposited in GenBank with accession number MK816926. To the best of our knowledge, this is the first report confirming the presence of BCVBV in Malaysia. In addition, BCVBV has been previously reported in other tropical countries including Brazil, India and Taiwan (Alexandre et al. 2016; Baranwal et al. 2010; Tsai et al. 2008).