Putative DNA Quadruplex Formation within the Human c-kit Oncogene
Top Cited Papers
- 8 July 2005
- journal article
- research article
- Published by American Chemical Society (ACS) in Journal of the American Chemical Society
- Vol. 127 (30), 10584-10589
- https://doi.org/10.1021/ja050823u
Abstract
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.This publication has 45 references indexed in Scilit:
- Two-repeat Tetrahymena Telomeric d(TGGGGTTGGGGT) Sequence Interconverts Between Asymmetric Dimeric G-quadruplexes in SolutionJournal of Molecular Biology, 2004
- G-rich Oligonucleotide Inhibits the Binding of a Nuclear Protein to the Ki-ras Promoter and Strongly Reduces Cell Growth in Human Carcinoma Pancreatic CellsBiochemistry, 2004
- c-kit Expression in Adenocarcinomas of the LungTumor Biology, 2004
- Two-Repeat Human Telomeric d(TAGGGTTAGGGT) Sequence Forms Interconverting Parallel and Antiparallel G-Quadruplexes in Solution: Distinct Topologies, Thermodynamic Properties, and Folding/Unfolding KineticsJournal of the American Chemical Society, 2003
- Crystal Structure of the Potassium Form of an Oxytricha nova G-quadruplexJournal of Molecular Biology, 2002
- The crystal structure of a parallel-stranded guanine tetraplex at 0.95Å resolutionJournal of Molecular Biology, 1997
- Structure–Function Correlations of the Insulin-linked Polymorphic RegionJournal of Molecular Biology, 1996
- Solution Structure of a DNA Quadruplex Containing the Fragile X Syndrome Triplet RepeatJournal of Molecular Biology, 1995
- Quadruplex structure of Oxytricha telomeric DNA oligonucleotidesNature, 1992
- Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loopsNature, 1989