Journal Of Tropical Pharmacy And Chemistry

Journal Information
ISSN / EISSN : 2087-7099 / 2407-6090
Total articles ≅ 204
Current Coverage
DOAJ
Archived in
SHERPA/ROMEO
Filter:

Latest articles in this journal

Mercy Badu, Mary-Magdalene Pedavoah, Nathaniel O Boadi, Irene Y Dzaye
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 286-298; https://doi.org/10.25026/jtpc.v5i4.296

Abstract:
This study evaluated the nutritional and medicinal properties of seeds from Adansonia digitata (BSF) and Balanite aegyptiaca (DDSF) plant. Proximate chemical composition, mineral elements composition, flavonoids, phenolics, antioxidant capacity, and anti-inflammatory properties were studied. Results obtained revealed that DDSF had the highest moisture, crude fat and crude protein content of 7.66 %, 42.80 %, 20.37 % respectively, whilst BSF gave the highest ash, crude fibre and carbohydrate content. Elemental analysis revealed BSF had the highest Mg content (313.65 mg/100g) and DDSF gave the highest Ca content (118.62 mg/100g). Additionally, DDSF gave the highest total phenolics (18.89 mg TAE/ 100 g), total flavonoids (8.80 mg QE/ 100 g) as well as the highest total antioxidant capacity of (19.62 mg AAE/ 100 g) dry of extract. Based on results obtained in this study, seeds obtained from the Adansonia digitata and Balanite aegyptiaca could be a potential source of functional food and antioxidant agents.
Armini Syamsidi, Nuur Aanisah, Reyhan Fiqram, Imanuel Al Jultri
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 245-253; https://doi.org/10.25026/jtpc.v5i3.297

Abstract:
MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method
Adelia Firandi, Didik Hasmono
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 270-279; https://doi.org/10.25026/jtpc.v5i3.291

Abstract:
Introduction: SARS-CoV 2 firstly emerged in China on December 2019 and it was spreading rapidly across the world until now. At this time, there is no vaccine or medication approved by the FDA. However, there are some FDA approved medicines for treating other diseases that can be used for Covid-19 based on tests. This review focuses on therapy efficacy, work mechanism, pharmacokinetic profile, safety, and future perspective. Method: Article review related to therapy on Covid-19 patients, particularly antiviral therapy which was the combination of lopinavir and ritonavir, chloroquine, hydroxychloroquine, remdesivir, and favipiravir. The reviewed relevant articles were observational study, in vitro test, case report, and clinical test. Results: A total of 13 articles met the requirement, 9 articles discussed the result of therapy during the medication of COVID-19 patients, 2 reports of in vitro test, and 2 results of clinical trials. Conclusion: From several studies that had been conducted, remdesivir, combination of lopinavir and ritonavir, as well as favipiravir showed benefits in various clinical studies on Covid-19 patients. Meanwhile, chloroquine and hydroxychloroquine showed limited effects and did not affect the decrease of mortality.
Harni Sartika Kamaruddin, Angriani Angriani, Carla Wulandari Sabandar
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 239-244; https://doi.org/10.25026/jtpc.v5i3.300

Abstract:
Background: Sawo fruit (Manilkara zapota (L.) P.Royen) is rich in antioxidant compounds like polyphenols, and has long been used to treat diarrhea and thypoid by natives of Toari and Langori villages of Kolaka district of Southeast Sulawesi Province. Both villages located at different geographical location according to their altitudes from the sea level. The polyphenols content of sawo fruit from these villages that has a correlation with its antioxidant activity has yet investigated and thus need more research. Objective: This study was aimed to determine the content of polyphenols in sawo fruit based on geographical growth difference, that are Toari and Langori villages. Material and Methods: The fruits were collected from two locations of the Kolaka district that are Langori and Toari villages. The polyphenols content in the methanol extract of Sawo fruit was determined qualitatively using FeCl3 and quantitatively using the Folin-Ciocalteu reagent measured by UV-Visible spectrophotometry. Gallic acid was used as the standard polyphenol of the assay. Results: The polyphenols content of sawo fruit from Langori found to be 1.48113 mg/g, while fruits from Toari contained 1.55747 mg/g of polyphenolics. Conclusion: The study showed that there was an influence of the geographical growth on the content of polyphenolics of sawo fruits.
Fatma Sari Siharis, Selpirahmawati Saranani, Nurlansi Nurlansi
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 233-238; https://doi.org/10.25026/jtpc.v5i3.299

Abstract:
Tokulo (Kleinhovia hospita) leaves are commonly used by Moronene people (Southeast Sulawesi) to treat headaches. This is supported scientifically from research which states that tokulo leaves have analgesic and anti-inflammatory activity. The NSAID group is included in the anti-rheumatoid arthritis therapy. To determine the anti-RA activity of this plant, a study was carried out on CFA-induced rats. Based on the results of the study, it is known that the ethanol extract of tokulo leaves has anti-RA and anti-inflammatory activity in CFA-induced rats. Keywords: Kleinhovia hospita, Rheumatoid Arthritis, Inflammation
Niken Indriyanti
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 218-222; https://doi.org/10.25026/jtpc.v5i3.289

Abstract:
Cyclophosphamide is one of the standard therapies for lupus, especially lupus nephritis based on its immunosuppressive effect. However, cyclophosphamide is also known as a nephrotoxic agent. Therefore, this research was aimed to measure the effect of cyclophosphamide at the dose that comparable to the human dose of 1 mg/kg BW on the kidney of lupus mice induced by means of 2,6,10,14-tetramethylpentadecane (TMPD). In this research, the IL-6 as a pro-inflammatory cytokine was tested by using flow cytometry method. In addition, the structural damage of the kidney tissues was assessed by means of Moroni’s kidney organ scoring method for lupus. The result showed that cyclophosphamide reduced the IL-6 significantly with the value of 36.72±22.79% for the TMPD-treated group; 32.59±9.97% for the cyclophosphamide group; and 30.25±4.48% for the naïve group. Moreover, the damages of the kidney tissues on the cyclophosphamide group were more severe than the TMPD-treated group. In conclusion, despite its anti-inflammatory effect which is useful for lupus, cyclophosphamide has a severe nephrotoxic effect which harms the patient. The effects may be a cause of the long interval use of cyclophosphamide. It can be a consideration for the further research and the next revision of the guideline for lupus nephritis treatment.
Fajar Prasetya, Supriatno Salam, Agung Rahmadani, Hadi Kuncoro,
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 229-232; https://doi.org/10.25026/jtpc.v5i3.322

Abstract:
Two fatty acid derivatives, 2-octenoic acid and 2-hexenoic acid were isolated from the extract of n-hexane of the Piper betle L. Var. Nigra (Piperaceae). The chemical structures were identified on the basis of spectroscopic evidence and compared to previously reported spectra. These isolated compounds appear for the first time in the plant.
Junaidin Junaidin, Syarifah Hudaya, Laode Rijai, Tetra Hidayat, Djoko Setyadi
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 223-228; https://doi.org/10.25026/jtpc.v5i3.304

Abstract:
Halal information on Food and Beverage Preparations, analyze for influence on Purchasing Decisions. Novelty research is the Role of Moderation to the relationship of Halal Information to Purchasing Decisions. Using structural model equations (SEM), there is a positive and significant impact of Halal Information on Purchasing Decisions. There is a positive and considerable moderation of Religiosity to the relationship between Halal Information and Purchasing Decisions. The practical implications of the study's results, empirically proving that Halal Information listed on Food and Beverage Preparations led to an increase in Purchasing Decisions, and consumer Religiosity showed significant differences. Advice for Food and Beverage manufacturers to keep halal information on Food and Beverage Preparations because it affects positive buying decisions.
Esravila Ariya Wibisono
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 264-270; https://doi.org/10.25026/jtpc.v5i3.275

Abstract:
Tuberculosis (TB) epidemic is a global health challenge, and WHO estimated the incidence of the new cases reaching 11.1 million people in 2017. Indonesia is classified as a high TB burden country, with 8% of its population infected by TB and ranks third in the world. Type-2 diabetes mellitus (T2DM) is known comorbidity for TB patients. TB-T2DM patients have a higher chance of morbidity, mortality, relapse, bacterial resistance, treatment failure, and slower sputum conversion than TB patients without T2DM. Recent studies suggest that metformin may have a potential synergistic role for TB-T2DM patients. Metformin has immunomodulator properties that can improve the body's immune response and inflammatory response against TB in individuals with T2-DM.
Rifatolistia Tampubolon, Hapsari Probowati, Judith Devi Manutilaa
Journal Of Tropical Pharmacy And Chemistry, Volume 5, pp 209-217; https://doi.org/10.25026/jtpc.v5i3.272

Abstract:
Background: Preeclampsia is a syndrome in terms of hypertension after 20-week pregnancy referring to a pregnant woman that previously had normal blood pressure, followed by having hypertension, proteinuria, edema and generally occurs in the third trimester of pregnancy. Preeclampsia is one of five main causes of maternal mortality up to 12% in the world as well. Objective: This study was conducted to describe nutritional status of pregnant women with preeclampsia in Aru Islands Regency, Dobo City, Southeast Maluku. Methodology: This study used mix methods, namely, quantitative and qualitative research with Case Study design. Qualitative research was to determine nutritional status of pregnant women with preeclampsia and quantitative research was to record nutrition intake of pregnant women and measure nutritional status of pregnant women with preeclampsia. Results & Discussion: Characteristics of participants with preeclampsia were more than 27 years old, worked as housewife that could be one of stress triggers and had some risk to increase preeclampsia cases because of stress that caused blood pressure increase. Preeclampsia was detected in pregnancy term of participants about 20-30 weeks according to Maternal and Child Health data. Preeclampsia risk was doubly by every increase in body weight (5-7 kg). Participants had body weight increase ranging from 8-25 kg which caused preeclampsia risk increase. Parameters of recommended dietary allowances of pregnant women including energy excess, protein deficit, fat excess, calcium and zinc deficiency were secondary factor of preeclampsia risk increase in Aru Islands Regency, Dobo City, Southeast Maluku.
Back to Top Top