Refine Search

New Search

Results in Journal Indonesian Aquaculture Journal: 234

(searched for: journal_id:(1150842))
Page of 5
Articles per Page
by
Show export options
  Select all
Deni Radona, Vitas Atmadi Prakoso, Irin Iriana Kusmini
Indonesian Aquaculture Journal, Volume 12, pp 15-20; https://doi.org/10.15578/iaj.12.1.2017.15-20

Abstract:
In fish culture, optimal growth could be influenced by various culture methods. Aim of the study was to evaluate the productivity of Barbonymus balleroides, lalawak in floating net cages, concrete ponds, and earthen ponds. Cultivation was designed with the circulation water system. Experiment was conducted using completely randomized design with three treatments and three replications for each treatment. The experimental fish, sized of 4.20 ± 0.64 cm SL and weight of 2.14 ± 0.99 g, were obtained from induced breeding. The stocking density used was 20 individuals/m3. Fish were fed 3% of total weight two times every day using commercial pellet with 35% protein content for 90 day. The result showed that lalawak reared in earthen pond was no significant difference on length, weight, and biomass compared with that one in concrete pond (P>0.05), but significantly different (P0.05) among the three different culture systems for survival rate and FCR. Lalawak reared on earthen pond system supported with optimal water quality could increase productivity value.
Rommy Suprapto, Alimuddin Alimudddin, Sri Nuryati, Imron Imron, , Bambang Iswanto
Indonesian Aquaculture Journal, Volume 12; https://doi.org/10.15578/iaj.12.1.2017.21-28

Abstract:
One of the important issues in catfish farming is motile aeromonad septicaemia (MAS) disease caused by the bacterium Aeromonas hydrophila. This study aimed to find the MHC-II marker potential for marker-based selection to generate MAS disease resistance of African catfish. PCR method was applied to identify catfish (body length: 7-8 cm) population that have MHC-II marker. Fish with and without the marker were then challenged by intraperitonially injecting of 0.1 mL/fish with A. hydrophila (105 cfu/mL). The results showed that the survival of fish having MHC-II marker (77.50 ± 4.00%) was higher than that of fish without the marker (53.33 ± 4.77%). Fish carrying MHC-II marker fish has also higher total erythrocytes, total leukocytes, phagocytic activity, and hematocrit levels than that of fish without the marker. The PCR results using specific primer for MHC-II showed a specific DNA band of 426 bp in fish having the marker, while there were no DNA bands in fish without the marker. Results of the PCR analyses showed that the percentage of progenies carrying MHC-II marker was 80%, while progenies from broodstock without the marker was 0%; this indicated that MHC-II marker could be inherited to the offsprings. Thus, the MHC-II marker could be used as a molecular marker of MAS disease resistance catfish.
Otong Zenal Arifin, Jojo Subagja, , Endang Haris Suhud
Indonesian Aquaculture Journal, Volume 12; https://doi.org/10.15578/iaj.12.1.2017.1-6

Abstract:
Barb (Barbonymus balleroides) considerably has economic potential as aquaculture commodity. However, there was still lack of development on aquaculture for this species. This study was conducted to observe the effect of different stocking density on growth of barb. The fish (body weight: 14.89 ± 0.13 g) were stocked in nine floating nets (dimension: 2 m x 2 m x 1 m) inside the concrete ponds with three stocking density treatments (10, 15, and 20 fish/m3). Each treatment consisted of three replications. Fish were fed on commercial pellet (30% of crude protein) as much as 3% of the biomass per day with twice a day of feeding frequency. Data of growth performances (body weight, specific growth rate, average daily growth, biomass, food conversion ratio, and survival rate) were collected every 30 days during 90 days of rearing period. Water quality variables (temperature, pH, and dissolved oxygen) were observed during experiment. The results showed that the optimal stocking density for the growth of barb was 10 fish/m3. Best value of food conversion ratio was found 10 fish/m3 compared with 15 and 20 fish/m3 (P<0.05). Meanwhile, there were no significant differences on survival rate between treatments. These results also showed the potential of rearing barb on culture ponds with appropriate stocking density.
, Koko Kurniawan, Muharijadi Atmomarsono
Indonesian Aquaculture Journal, Volume 12, pp 29-36; https://doi.org/10.15578/iaj.12.1.2017.29-36

Abstract:
Several ways have been done to encounter shrimp disease affecting cultured shrimp in Indonesian ponds in the last two decades. This research was aimed to find out the effect of different application of probiotic RICA4, RICA5, and RICA3 method on survival rate and production of white-leg shrimp (Litopenaeus vannamei) cultured in ponds aerated with supercharge blower. RICA probiotics are bacteria probiotics produced by the Research and Development Institute for Coastal Aquaculture, originally isolated from seaweed and sea sediment. This experiment was carried out in completely randomized design using nine 250-m2 experimental ponds stocked with 15 shrimp fries/m2. There were three treatments namely: A=alternate use of three probiotics RICA4, RICA5, and RICA3; B=combination use of three probiotics RICA4, RICA5, and RICA3; and C=control (without probiotic), each treatment with three replications and cultured with supercharge blower. Variables observed in this study were survival rate and production of the shrimp calculated at the end of experiment, total vibrio count (TBV) and total plate count of common bacteria (TPC) of the pond waters and sediments monitored every two weeks. The results showed that application of probiotic RICA4, RICA5, and RICA3 applied either in alteration or in combination significantly increased survival rate (P0.05) of the white-leg shrimp. TBV/TPC ratio in the control pond waters after 10-weeks culture (over than 10%) was relatively dangerous for the cultured white-leg shrimp. This shows that application of probiotic could prevent the growth of Vibrio spp in the cultured shrimp pond water.
, Agus Budianto
Indonesian Aquaculture Journal, Volume 12; https://doi.org/10.15578/iaj.12.1.2017.37-42

Abstract:
Coral disease surveys were conducted in Bintan, Kepulauan Riau Province. The purpose was to identify the abundance of corals showing signs of Yellow Syndrome (YS) disease and to describe similar pathological signs to that of AYBD throughout Bintan District. Three belt transects (2 m x 50 m in size) were set up to determine the abundance of coral reef attacked by YS disease. Line intercept transects were used to determine the percentage of live corals in the surveyed areas. The survey showed that the YS disease syndrome attacked 8 different genera i.e. Acropora, Montipora, Porites, Pavona, Turbinaria, Favia, Platygyra, and Favites. The highest attack happened at Mapur Island (0.06 kol/m2) on Porites lutea, Turbinaria peltata, T. mesenterina, Acropora bruggemanni, and Pavona frondifera. The survey also indicated that there may have been at least two types of YS i.e. the first type caused by a boring and/or over-growing sponge species and the second type caused by a kind of pathogenic microbe. Regardless the causal agent of YS, the severity of YS attack on coral urged immediate action to be undertaken and should include initial microscopic and histology examinations. Based on this initial microscopic and histology examinations it was found out that YS bears a close resemblance to the Arabian Yellow Band Disease. This study, however, argued that the word “disease” may have been incorrectly used without identifying a specific causal agent.
Asep Sopian, Alimuddin Alimuddin, Imron Imron, Harry Krettiawan, Fajar Anggraeni, Desy Nurul Astuti
Indonesian Aquaculture Journal, Volume 12, pp 7-13; https://doi.org/10.15578/iaj.12.1.2017.7-13

Abstract:
High size variation of giant freshwater prawn was found in harvest and resulting in low productivity. Marker assisted selection may be useful to generate broodstock that produces progeny with high growth and homogeneity. This study was conducted to obtain growth related molecular marker in giant freshwater prawn. Genomic DNA was extracted from swimming leg (pleiopods) of 10 giant freshwater prawns fifth Generation for existence of SNP identification, consisted of 5 fast growth (FG) and 5 slow growth (SG). While for SNP confirmation and resolving power of specific primer studies. The pleiopods sample was taken from six generation of 201 giant freshwater prawns, consisted of 129 fast-growth (FG) with 16.06 ± 2.48 g body weight and 72 slow-growth (SG) with 6.05 ± 0.90 g body weight. Oligonucleotide primers were designed according to Gene Bank database of crustacean hyperglycemic hormone (CHH) gene sequence. The amplified DNA fragment was then sequenced. The results of sequencing showed there was one base different in nucleotides of FG and SG prawns. Six set of primers were designed based on those CH gene sequence. PCR analysis resulted one set of primers which showed a specific amplification product of 280 bp for growth. The result of sequence analysis using the basic local alignment search tools showed that the nucleotide sequence of those PCR products had similarity of 99%-100% with CHH gen of M. rosenbergii. Thus, a candidate of growth related molecular marker have been identified for giant freshwater prawn.
Eni Kusrini, Alimuddin Alimuddin, Mohammad Zairin, Dinar Tri Sulistyowati
Indonesian Aquaculture Journal, Volume 11; https://doi.org/10.15578/iaj.11.1.2016.1-7

Abstract:
Big size betta (Giant) have a high economic value compared to normal size betta, and over expression of growth hormone gene can produce giant fish. As an initial step of giant transgenic betta productions, this study was conducted in order to obtain DNA plasmid concentration which provide higher hatching and survival rate of betta larvae. Construction of PhGH pCcBA gene contains growth hormone gene of Siamese catfish (PhGH) and it is controlled by the CCBA promoter. Betta imbellis broodstocks were spawned naturally, and embryos were collected 1-2 minutes after spawning time. One hundred embryos were dipped in 2 mL of transfectan X-treme gene which containp CcBA-PhGH construction genes (50 µg/mL), on room temperature for about 30 minutes. Treatments on this study were different transfectant : DNA plasmid ratiosnamely:A (0,75 µL: 0,25 µL); B (0,75 µL : 0,50 µL); C (0,75 µL: 0,75 µL), D as Control 1(without transfectant, 0,25 µL DNA); E.as Control 2(0,75 µL transfectant, without DNA), and Fas control 3 (without transfectant and without DNA). Every treatments was repeated three times. Transfection embryos were hatched on a container (1L Volume). Study results showed that hatching rate and larvae survival rate (4 days after hatching) on treatment A were the same with the control, but slightly higher than B and C treatments. PCR analysis with DNA template showing that PhGH gene were found on embryos and larvae (pooled sample) of treatment A, B and C. Furthermore, RT-PCR analysis showing the existence of mRNA PhGH expression on embryos and larvae (pooled sample). Therefore, embryo transfection with transfectant ratio 0,75 µL and DNA 0,25 µLshowing the best results.
Sekar Ayu Chairunnisa, , Alimuddin Alimuddin, Sri Murtini, Ayi Santika, Dwi Hany Yanti
Indonesian Aquaculture Journal, Volume 11; https://doi.org/10.15578/iaj.11.1.2016.31-39

Abstract:
Koi herpesvirus (KHV) is one of the major pathogen for koi and common carp which cause high mortality and economic losses for the farmer. The purpose of this study was to determine the efficacy of glycoprotein-11 (GP-11) KHV DNA vaccine and compared to GP-25 KHV DNA vaccine. The vaccine in the form of naked DNA plasmidwas delivered by intramuscularly injection to the 3-month-old koi. The fish were divided into six groups, i.e. unvaccinated group (negative control C- and positive control C+), and vaccinated group (2.5 μg/100 μl of GP-11 (group 1), 7.5 μg/100 μl of GP-11 (group 2), 12.5 μg/100 μl of GP-11 (group 3), and 12.5 μg/100 μl of GP-25 (group 4)). At day 42 post vaccination, all fish of each groups were challenged by injecting KHV titre 10-3 FID50. Number of dead fish was counted everyday after the challenge until 30 days. The results showed that vaccinated fish were had survival rate of 83.33-93.33% (group 2, 3 and 4). It’s show that GP-11 KHV DNA vaccine has high efficacy. As conclusion, GP-11 DNA vaccine could be an alternative DNA vaccine for preventing KHV infection.
, Bambang Iswanto, Imron Imron, Selny Febrida, Raden Roro Sri Pudji Sinarni Dewi
Indonesian Aquaculture Journal, Volume 11; https://doi.org/10.15578/iaj.11.1.2016.9-13

Abstract:
Research Institute for Fish Breeding has produced transgenic African catfish (Clarias gariepinus) containing stripped catfish growth hormone gene (PccBA-PhGH) with growth 19.86% faster than that of non-transgenic fish. This fish has high potential to be released and utilized for fish farming sector to increase national production. However, there is not yet information about environmental risk of this fish. One of the major fitness traits determining potential environmental risk is predator avoidance. This study aimed to determine the predator avoidance ability of transgenic African catfish in an experimental laboratory condition. In this study, thirty five individuals each of transgenic and non-transgenic with body weight of about 0.1 ± 0.019 g were communally stocked in 60 cm x 40 cm x 40 cm aquarium with limited feeding frequency (ad libitum twice a day). One day after the fish were stocked, the predators were added to each aquarium. The non-transgenic and transgenic with body weight of 1.0 ± 0.024 g were stocked as predators as many as five individual in each aquarium. After approximately two weeks of predation, all remaining fish were collected for transgenic verification by PCR method. Genomic DNA was isolated from fin tissue of individually survivors. The results of this study showed that the transgenic fish had worse predator avoidance and lower cannibal than non-transgenic (P0.05) in limited food. The transgenic fish may have lower fitness than non-transgenic.
, Usman Usman, Rachman Syah
Indonesian Aquaculture Journal, Volume 11; https://doi.org/10.15578/iaj.11.1.2016.23-30

Abstract:
Very low naturally mating rate of pond-reared tiger shrimp broodstock is probably due to the slow maturation of the male stock. The aim of this study was to evaluate the salmon gonadotrophin releasing hormone analoque (sGnRHa) in stimulating the gonadal maturation of male stock of pond-reared tiger shrimp. The treatments were three dosages of sGnRHa at 0.1 (OV-1), 0.2 (OV-2), and 0.3 (OV-3) mL/kg of shrimp weight and control was eye stalk ablation (AB). The sGnRHa was administered via injection three times with one week interval. Male stocks with average initial body weight of 82.1 g were randomly distributed into four of 10 m3 concrete tanks, 26 males for each tank. Variables observed were performances of spermatophores and profiles of amino acid and fatty acid of muscle of the male stocks. After induction, number of male maturing indicated by spermatophores releasing from terminal ampullas was higher in shrimp induced with OV-1 (80.8%) compared to control which was only 46.1%. Furthermore, shrimp treated OV-2 had the highest spermatophore weight of 0.16 g compared to control (0.11 g) and other two groups. Amino acid profiles improved as the dose of sGnRHa increased up to 0.2 mL/kg from 61.23% for ablated male becoming 71.27% for OV-2. Total fatty acid also tended to improve by increasing the dose of hormone injection, however, the ablated male had higher total fatty acid content than that of OV-1. The present finding demonstrated that the dose of sGnRHa to stimulate the gonadal maturation of pond-reared male tiger shrimp could be applied at range between 0.1-0.2 mL/kg of shrimp weight.
Bambang Iswanto, Imron Imron, , Rommy Suprapto
Indonesian Aquaculture Journal, Volume 11; https://doi.org/10.15578/iaj.11.1.2016.15-21

Abstract:
Genetic improvement of the African catfish (Clarias gariepinus) in Indonesia for increasing growth performance has been conducted by Research Institute for Fish Breeding at Sukamandi through mass selection. Collection and characterizations of the founder populations, building the synthetic base population, first generation and second generation through mass selection were conducted during 2010-2013. Later, in 2014 it was followed by building the third generation. The present study aimed to find out the genetic gain in the third generation in term of response to selection for body weight. Fifty-two pairs of the selected (fast growing) individuals from the second generation were mated to produce the third generation. As a comparison, five pairs of average-sized individuals were mated to produce the control population, as a second generation representative. Larval rearing, nursery and grow-out phases were respectively held for 25 days in the aquaria, 30 days in the concrete ponds and 60 days in the concrete ponds. At the end of each phase, individual samplings of body weight were undertaken. The results showed that mean body weight of the third generation was higher than that of control population at the end of larval rearing phase (0.21 ± 0.26 g versus 0.20 ± 0.15 g), nursery phase (6.12 ± 2.93 g versus 5.80 ± 3.50 g) and grow-out phase (198.67 ± 82.82 g versus 165.22 ± 71.09 g). Those results revealed that response to selection for body weight of the third generation was positive, i.e. about 20.24% (33.45 g).
Lili Sholichah, Munti Yuhana, Angela Mariana Lusiastuti, Tri Heru Prihadi
Indonesian Aquaculture Journal, Volume 11; https://doi.org/10.15578/iaj.11.1.2016.41-47

Abstract:
Koi Herpesvirus (KHV) is a malignant virus infecting the goldfish and koi in all stadia and cause mortality up to 95%. The purpose of this study was to determine the potency and efficacy of inactivated-vaccine in addition with adjuvant against KHV in koi fish. The viral propagation was done using a KF-1 cell line in 25 cm3 flask. The cultured virus was harvested on 12 days post inoculation, and then the harvested virus was inactivated with 0.1% formalin as inactivated-vaccine. Three hundred of test fish (10.38 ± 1.25 g) maintained in 126 L of plastic containers with aeration, and fed with pellets twice a day. After 14 days of adaptation, the fish were divided into five treatments (A= vaccine; B= vaccine + Complete Freund’s Adjuvant; C= vaccine + Incomplete Freund’s Adjuvant; K+= positive control, and K-= negative control) and each treatment has four replicates. Vaccine was given by injecting intramuscularly of 0.1 mL per fish. All fish were challenged by injecting intramuscularly of 0.1 mL of KHV virus with concentration of 104.58 TCID50/mL after 21 days post vaccination. The results showed that the B treatment had higher (P<0.05) values of hematocrit level, lysozyme activity, and titer of antibody compared with positive control. In addition, the survival of fish in B treatment also had the highest percentages and significantly different compared to other treatments (P<0.05). The conclusion of this research was the application of inactivated KHV vaccine in 0.1% formalin with the addition of Complete Freund’s Adjuvant through the injection dose 0.1 mL fish-1 in 104.58 TCID50/mL capable to enhance the immune responses and raised the optimal protection of KHV antibody in koi fish.
Taufik Ahmad, Lilis Sofiarsih, Nuriadi Nuriadi, G. Apriyana
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.89-97

Abstract:
Many hatcheries successfully produced and sold cherax as ornamental crayfish. The attempt to culture cherax in earthen pond to produce consumable size yabbies facing the fact that cherax is a good hole digger and usually escapes through the hole in dyke. Single-o-shelter meant to provide shelter for every single spawner as well as hideout for the juvenile produced. The shelter for spawner was a 25 inches long and 2.0 inches diameter PVC pipe randomly spread on pond bottom. Aquatic weed (Vallisneria torta) grew in the shallow part of pond to provide hiding place for juvenile. The species stocked is huna and redclaw, each at density of 2 and 6 sets of spawner. One set of spawner consists of 3 males and 5 females weighing averagely around 20 g each. The experimental units are randomly selected to facilitate random block design in 2 rearing period as replicate. The pond dimension is 10 m x 10 m, divide into 3 compartments i.e. feeding, ground, nursery ground and harvest ditch. Water depth at nursery ground was 30 cm and at the other compartments at 60 cm. Follow gravity force, the water in ponds flows at 50—100 L minute-1. Self-made diet distributed into pond twice a day to meet 3% daily feeding ration. Survival rate and specific growth rate of spawner as well as juvenile produced and number of gravid female checked at the end of each rearing period or every 3 months. After 6 months, average weight of redclaw and huna reaching 146.12 ± 34.47 g and 103.7 ± 29.83 g, respectively. Redclaw produced progeny of 5 size groups and huna produced only 2 groups. Respective to the species, average weight of the first offspring batch was 39.03 ± 5.33 and 26.83 ± 2.09 g. Redclaw at 2 sets of spawner and male grow faster than of 6 sets of spawner and female. No survival rate significant difference among ponds indicates that single–o-shelter technique provides sufficient shelter for spawner to grow and reproduce. Male monosex redclaw culture in earthen pond seems to be more promising than mixed-sex and female monosex culture for consumable size production of either huna or redclaw.
Rudhy Gustiano, Laurent Pouyaud
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.107-112

Abstract:
Pangasiids are economically important riverine catfishes generally residing in freshwater from the Indian subcontinent to the Indonesian Archipelago. The systematics of this family are still poorly known. Consequently, lack of such basic information impedes the understanding of the biology of the Pangasiids and the study of their aquaculture potential as well as improvement of seed production and growth performance. The objectives of the present study are to clarify phylogeny of this family based on a biometric analysis and molecular evidence using 12S ribosomal mtDNA on the total of 1070 specimens. The study revealed that 28 species are recognised as valid in Pangasiidae. Four genera are also recognized as Helicophagus Bleeker 1858, Pangasianodon Chevey 1930, Pteropangasius Fowler 1937, and Pangasius Valenciennes 1840 instead of two as reported by previous workers. The phylogenetic analysis demonstrated the recognised genera, and genetic relationships among taxa. Overall, trees from the different analyses show similar topologies and confirm the hypothesis derived from geological history, palaeontology, and similar models in other taxa of fishes from the same area. The oldest genus may already have existed when the Asian mainland was still connected to the islands in the southern part about 20 million years ago.
Ketut Suwirya, Nyoman Adiasmara Giri, Muhammad Marzuqi, Sophia Lasma Sagala
Indonesian Aquaculture Journal, Volume 2, pp 1-5; https://doi.org/10.15578/iaj.2.1.2007.1-5

Abstract:
Cultured mud crabs (Scylla spp.) are commonly fed with ‘trash’ fish. Insufficient supply, high cost and variable quality of ‘trash’ fish has lead to a need to develop costeffective and environmentally friendly formulated diets. This study was conducted to determine quality of selected feed ingredients as protein sources in mud crab diets based on their nutrient composition and digestibility coefficients for dry matter (ADMD), crude protein, lipid and energy. The digestibility coefficients for ADMD ranged from 82.46% to 89.20%. Animal-based feedstuffs such as shrimp head, tiny shrimp and squid liver meal had higher ADMD values than fish meal. Of the plant-based feedstuffs, soy bean meal had the highest ADMD values (89.20%) and corn gluten had the lowest (82.46%). Corn gluten had the lowest protein digestibility (78.81%) and soy bean meal had the highest (96.05%). The lowest energy digestibility (71.13%) was obtained in corn gluten meal. Soy bean meal had a higher energy digestibility value (98.48%) than fish meal (85.95%). All animal meal sources had similar energy digestibility values (85.86%—92.09%).
Usman Usman, Kamaruddin Kamaruddin, Neltje Nobertine Palinggi, Taufik Ahmad
Indonesian Aquaculture Journal, Volume 2, pp 7-13; https://doi.org/10.15578/iaj.2.1.2007.7-13

Abstract:
The experiment aimed to evaluate the optimal level of fermented blood meal used in grow-out diets for tiger grouper, as an alternative protein source to fish meal. Juvenile tiger grouper, initial weight 31.1 ± 2.1 g, were stocked into 1 m x 1 m x 2 m floating net cages at 20 fish cage-1. The treatment applied was isoprotein and isocaloric diets formulated to contain fermented blood meal (FBM) of 0%, 7.5%, 15.0%, 22.5%, and 30.0% replacement of fish meal protein. The diets were fed to the fish twice a day to satiation for 20 weeks. Based on the Tukey test, the fish fed 0%–15.0% FBM demonstrated similar performance (P>0.05) to those fed the control diet (FBM0) in terms of specific growth rate, weight gain, and feed and protein efficiency. Specific growth rate, weight gain, feed efficiency and protein efficiency of the fish fed 22.5%–30.5% FBM were significantly lower (P
Des Roza, Fris Johnny
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.1.2007.15-22

Abstract:
Milkfish, Chanos chanos and humpback grouper, Cromileptes altivelis hatcheries have developed at Gondol, Bali since 1995 and until now still rely on rotifers, the main natural food, supply. Recent problem on mass culture of rotifer, Brachionus sp. is harvest failure caused by fungus infection. Under light microscope, infected eggs and bodies of the rotifers was filled with numerous aseptate hyphae. Two isolates of fungi were isolated from rotifer eggs and carcass on June 21st, 2004 and on June 25th, 2004 obtained from milkfish and humpback grouper hatcheries at Gondol. Based on its morphological characteristics, the pathogenic fungus was identified as Lagenidium callinectes which grows optimally at 25°C and survives in 1.0%, 2.5%, and 5.0% NaCl as well as in 1.0% and 2.5% KCl. Both of the present isolates utilize only 8 out of 26 carbohydrates and derivatives tested as carbon, nutrition and energy sources. This finding is the first report on rotifer, Brachionus sp. infected with L. callinectes causing up to 100% mortality.
Rudhy Gustiano, Anang Hari Kristanto
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.1.2007.27-33

Abstract:
Possible use of pangasiid hybrids in aquaculture might generate potential impacts on wild populations. Therefore, rapid identification tools in the field such as growth rate are urgently needed. This study examines morphological characters and growth performance of P. djambal and P. hypophthalmus and their reciprocal hybrids. A detailed morphological study analysed 32 morphometric measurements and 5 meristic counts on hybrids of Pangasius djambal and P. hypophthalmus. Morphometric analysis and meristic counts showed that the reciprocal hybrids have intermediate characters except for gill rakers number which were lower than that of parental species. In general, the hybrids have tendency to be like P. hypophthalmus rather than P. djambal. The only typical character P. djambal appearing in hybrids is teeth shape, both vomerine and palatine. It was shown that the true hybrids have seven pelvic fin rays. Eight months of growth comparison in earthen ponds showed that the hybrids have a better performance for specific growth rate than the parental stock.
Sulaeman Sulaeman, Andi Parenrengi, Emma Suryati, Rosmiati Rosmiati
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.1.2007.23-26

Abstract:
Two different colors (green and brown) of Kappaphycus alvarezii have been farmed in Indonesian waters for many years. This study aimed at comparing two ‘varieties’, i.e. green and brown, both genetically and morphologically. Samples for DNA analysis were collected from a farmer in Pinrang Regency, South Sulawesi. Five universal primers i.e. Ca-01, Ca-02, P-40, P-50, and DALRP were selected to obtain DNA genetic markers in differentiating the green and brown varieties. To compare coloration patterns during cultivation and the growth performance of both varieties, a field experiment was performed in a seaweed farming area in Pinrang Regency, during dry season of August-September 2004. The result of genetic assessment showed that the five selected primers revealed different RAPD banding pattern for both varieties. P-50 and DALRP primers demonstrated the greatest amplification in differentiating RAPD fragment between green and brown varieties. Fragment 900 bp and 1.300 bp were consistently generated in the green variety but were not amplified in the brown variety. The result of the field study confirmed that the coloration pattern of green and brown varieties was fixed; no interchange in color occurred during one crop cultivation.
Sudarto Sudarto, Agus Priyadi, Jack Slembrouck, Laurent Pouyaud, I Wayan Subamia
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.159-162

Abstract:
Comparing two different rearing systems in fish production through stagnant and recirculation water systems showed that recirculation system has several benefits such as reducing manpower, and minimize or eliminate in using antibiotics and also eliminate the grow out of diseases, increasing the profits due to increase in density of fish cultured in the system, and water quality remain stable in optimal condition.
Jhon Harianto Hutapea
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.99-105

Abstract:
The experiment was conducted in order to figure out the effect of incubation temperature on embryonic development of yellowfin tuna, Thunnus albacares eggs. Five different incubation temperatures were applied as treatments, i.e.: 24°C, 26°C, 28°C, 30°C, and 32°C with 3 replicate each. Ten micro plates with lid (IWAKI, Japan) were used; each has 6 well and 10 mL volumes. Five micro plates were used for experiment and five for balance on shaker. Three well of each micro plate were filled with 8 mL ultra violet sterilized sea water and 50 fertilized eggs. Temperature was set using Multi Thermo Incubator which has 5 level racks. Temperatures were set from the lowest to the highest on bottom to upper rack order. To maintain eggs dispersed in the medium, shaker on each rack was operated at 150 RPM. The embryo was monitored every 30-60 minutes depends on embryonic stage development using Microscope which was connected to Digital Camera DXM 1200F. Image analyses by Image Analyzer Program. The results showed, incubation temperature was significantly affect (P<0.05) embryonic development and hatching time of yellowfin tuna (Thunnus albacares) eggs. Optimum incubation temperature for embryo development and hatching was 28°C. Decreased on incubation temperature slows down embryo development at all stages, and vice versa, increased on incubation temperature accelerates embryo development.
Gede Suwarthama Sumiarsa, Ronald P. Phelps
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.75-88

Abstract:
Lipid and fatty acid profiles were described for copepod nauplii Apocy clops panamensis from fertilized brackish water ponds, and after being acclimated to fullsea water salinity. Mean total lipid content of copepod nauplii collected from ponds fertilized with inorganic fertilizer combined either with alfalfa meal, rice bran, wheat bran, and a combination of these fertilizers ranged from 5.66 ± 0.15 to 7.76% ± 0.27%. Non-polar (neutral) lipid fraction of pond copepod nauplii was a significantly higher percentage of the total lipid content (74.5 ± 1.8 - 93.5% ± 1.0%) compared to those of polar lipid (6.5 ± 1.0 - 21.3% ± 1.8%) (P= 0.000). DHA/EPA ratio in neutral lipids ranged from 1.8 ± 0.2 - 2.0 ± 0.1 with no significant differences in three fertilization regimes. DHA was 27.5% ± 0.56% of the neutral lipids and EPA 14.8% ± 0.8%. Acclimation of copepod nauplii for six hours from brackish to full-sea water salinity reduced their lipid content and individual dry weight significantly. Mean total lipid content was reduced 44.2%, non-polar lipid was reduced 46.9% and polar lipid was reduced 24.4%. Acclimation altered the DHA/EPA ratio, in the neutral fraction the ratio increased 26.3% but in the polar fraction it decreased 25%.
Philip Teguh Imanto, Gede Suwarthama Sumiarsa, Made Suastika
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.133-139

Abstract:
The most important factor to high mortality rate in larval rearing is feeding success in early larval stage related to kind and size of natural live food. Copepod basically is the main source of natural food in the open ocean having some advantages such as smaller size of nauplii, attractive movement and high nutritional value. Observation on population dynamic of harpacticoid copepod Euterpina acutifrons was carried out using 5-L plastic bucket with initial density 100 ind./L. Green algae Nannochloropsis sp. was added to culture media at density of 50,000 cells/mL as a basic feed and additional feeds given were wheat flour (group A) and chicken liver (group B) at a rate of 50 mg/bucket. The result showed that there was no difference on population pattern in both groups where the incubation time took eight days to hatch, from nauplii to the copepodite stage was three days and from copepodite to adult copepod took five-to-six days. The differences came up from population number: in group (A) the highest number of copepod-bearing-egg was only 133 ind., nauplii production up to 62,833 ind. and number of copepodites was 22,333 ind. lower compared to group (B) with the highest copepod-egg was 308 ind., nauplii was 113,333 ind. and copepodite was 51,167 ind. The conclusion pointed out that the kind of food did not influence population pattern (quality) but gave effect to population growth.
Usman Usman, Kevin C. Williams, Mike A. Rimmer
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.113-120

Abstract:
The apparent digestibility (AD) of eight feed ingredients are widely available in Indonesia was determined. In each of two 5x5 latin-square experimental, tiger grouper Epinephelus fuscoguttatus juveniles (100—150 g) were fed a reference diet and four test diets in accordance with the latin-square design. Test feed ingredients were substituted at rates of 40% for animal meals or 30% for plant meals. Chromic oxide was used as the digestibility marker. In determining the ingredient AD, the substitution ratio was calculated as the proportion of the nutrient (or energy) contributed by the test ingredient on an ‘as-is’ basis. Digestibility tanks were steeply slope 200 L cylindroconical tanks with a bottom outlet to facilitate faecal collection, which was carried out at 3-hourly intervals throughout the day. Each collection period took 5—7 days with a similar acclimatization time between diets. A combined ANOVA of the data for both experimental showed no difference (P>0.05) in the AD’s for each reference diets. Thus for comparative purpose, the derived AD’s of the test ingredients were analysed as a single ANOVA. The digestibility of animal meals was generally high (>59% for dry matter, >83% for protein, >65% for lipid, and >70 for gross energy) while that of plant meals was slow (<53% for dry matter, <53% for protein, <66% for lipid, and <46% for gross energy). This information will enable grow-out feeds for tiger grouper to be formulated on a least-cost digestible nutrient basis.
Ketut Suwirya, Muhamad Marzuqi, I Nyoman Adiasmara Giri
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.121-125

Abstract:
It is widely recognized that a major constraint to development of a mud crab aquaculture industry is the availability and formulation nutritionally adequate but relatively low cost diets. Development of artificial diets, which seek to minimize inclusion of expensive feed ingredients such as fish and terrestrial meals, is considered to be a priority for improving the profitability of this emerging industry. Typically, carbohydrates such as starches are relatively cheap and therefore offer opportunity to supply dietary energy at low cost. The study examines the capacity of mud crab, Scylla paramamosain to utilize a range of dietary cassava meal as carbohydrate source. Four levels of cassava meal were used at inclusion levels of 0%, 10%, 20%, and 30% in diets. Mud crabs will readily accept the diet containing relatively high levels of cassava meal. This experiment proved that mud crab which fed 10% dietary cassava meal gains weight more than the one fed diet without dietary cassava meal. The increasing level of cassava meal to more than 10% in diet reduced final weight and weight gain. To some extent, mud crab, Scylla paramamosain is capable to use dietary carbohydrate from cassava meal. The finding raises the possibility to include 10% cassava meal in formulation low cost diet for mud crab.
Rosmiati Rosmiati, Emma Suryati, Andi Parenrengi, Sulaeman Sulaeman
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.127-131

Abstract:
Molecular biotechnology approach has been applied on sponge for preventing diseases on fishery culture. This is important for anticipating and avoiding the using of amount of sponge in nature. The present study aims to screen the antimicrobial (oxytetracycline and chloramphenicol) genes of sponge. DNA extraction of samples was done using the DNeasy Plant mini kit, Phenol-Chloroform and modification of Phenol-Chloroform methods. The presence of oxytetracycline and chloramphenicol genes in sponge was detected using Polymerase chain reaction (PCR) technique. Result of the study showed that four species (Sylotella aurantium, Acanthella kletra, Gelliodes fibulatus, and Auletta sp. were amplified for oxytetracycline and two species (Auletta sp. and Pericharax sp.) of sponge were amplified for chloramphenicol at each 226 bp.
Akhmad Mustafa, Jesmond Sammut
Indonesian Aquaculture Journal, Volume 2; https://doi.org/10.15578/iaj.2.2.2007.141-157

Abstract:
Acid sulfate soils (ASS) contain sufficient pyrite which, when oxidised following excavation for brackishwater aquaculture ponds, will generate acid and mobilise toxic metals. Production in affected ponds can be low due to poor growth of shrimp and fish, mass mortalities of stock and low plankton blooms. The resultant low soil pH can also cause poor klekap production due to the retention of phosphorus associated with elevated concentrations of Fe and Al in the pond soils. A series of experiments was conducted to determine the effects of different soil amelioration techniques and dosage of phosphorus (P) on soil and klekap production under laboratory conditions. The treatments consisted of two factors. The first factor tested was different techniques for ASS improvement (non-improvement, improvement through liming and improvement through remediation involving forced oxidation of pyrite, flooding and flushing of oxidation products). The second factor tested was phosphorus dosages, that is, with phosphorus and without phosphorus-based fertilizer. Each treatment had three replications. The experiment showed that liming and remediation had the same effect on several soil variables; they raised the soi pH (pHF, pHFOX, pHKCl) and decreased SPOS, Fe and Al. Remediation of ASS decreased retention of P and increased available-P of soil, whereas liming did not show a significant effect on retention of P and available-P in the doses used for this experiment. The interaction between the different soil improvement techniques and phosphorus fertilising showed a significant effect on klekap production with the highest klekap production of 23.21 mg/cm2 found in remediated soil and with a phosphorus fertiliser dosage of 75 kg/ha.
Estu Nugroho, Mulyasari Mulyasari, Anang Hari Kristanto, Fauzan Ali, Gunawan Gunawan
Indonesian Aquaculture Journal, Volume 3, pp 23-28; https://doi.org/10.15578/iaj.3.1.2008.23-28

Abstract:
The objective of this research is to evaluate the genetic variability of freshwater prawn, Macrobrachium rosenbergii. The genetic variability of freshwater prawn collected from Makassar-Sulawesi, Pangkalanbun-Kalimantan, Jambi-Sumatra, Sukabumi-Java, and GIMacro strain was examined using polymorphism of the mitochondria DNA (mtDNA) markers. Twelve composite haplotypes were detected following digestion of CO1 sequences with four endonucleases: Hae III, Rsa I, Mbo I, and Taq I. The average haplotype diversity was 0.217. Significant genetic difference was observed among freshwater prawn populations, especially among Makassar-Sulawesi population and others. Makassar-Sulawesi strain has future prospect for genetic resources in breeding program.
, Ketut Mahardika
Indonesian Aquaculture Journal, Volume 7, pp 55-60; https://doi.org/10.15578/iaj.7.1.2012.55-60

Abstract:
Characteristic of Megalocytivirus infection has been known to produce formation of inclusion body bearing cells (IBCs) on internals organs of fish predominantly on spleen and kidney. Megalocytivirus that infected grouper is known as Grouper Sleepy Disease Iridovirus (GSDIV). This study was conducted to answer the effect of entry sites of GSDIV on distribution of enlarged cells formed on the internal organs of humpback grouper Cromileptes altivelis. Enlarged cells were observed histologically under the light microscope on spleen, head kidney, trunk kidney, liver, gill, heart, stomach, intestine, muscle and brain. Entry sites were designated to intramuscularly injection, intraperitoneally injection, dipped gill and inoculum added feed. Enlarged cells were formed on spleen, head kidney, trunk kidney, liver, gill, heart, stomach, muscle, except on intestine and brain. All the entry sites resulted in formation of enlarged cells on spleen, head kidney, trunk kidney, liver, heart. Spleen and head kidney were the most frequent observed organ. These results suggested that distribution of enlarged cells were not affected by the entry site of GSDIV.
Afifah Nasukha, Titiek Aslianti, Agus Priyono
Indonesian Aquaculture Journal, Volume 7, pp 105-114; https://doi.org/10.15578/iaj.7.2.2012.105-114

Abstract:
Vertebral development is one of the main indicators of organism growth. The aim of this study was to know the vertebral development of cobia Rachycentron canadum in larval stage (20 day post hatch). Vertebral assay was done with double staining methods. The result showed that cobia larvae from 0 dph up to 5 dph did not have cartilage. On 5 dph up to 10 dph had pre cartilage phase composed by calcium and on 10 dph up to 18 dph were cartilage phase and marked with blue color by alcian blue. Vertebral was formed perfectly as bones on 18 dph marked with red color by alizarin red. On 20 dph, cartilage had been fully transformed to bones, and the segment of vertebral was clearly formed. Measurement showed that length of cobia vertebrae was 20.20±3.90 mm, vertebrae segment was 0.91±0.11 mm and number of vertebral segments were between 25-26 segments.
Indonesian Aquaculture Journal, Volume 6, pp 191-204; https://doi.org/10.15578/iaj.6.2.2011.191-204

Abstract:
In the development of scallop cultivation in Japan, larvae collection and propagation become an important factor. Although the monitoring program has been conducted, modeling of species distribution is becoming an important tool for understanding the effects of environmental changes and resources management. This study was conducted to construct a model for providing estimation of the scallop larvae distribution in Funka Bay, Hokkaido, Japan using the integration of remote sensing, Regression Quantile (RQ) and Geographic Information System (GIS)-based model. Data on scallop larvae were collected during one year spawning season from April to July 2003. Environmental parameters were extracted from multi sensor remotely sensed data (chlorophyll-a and sea surface temperature) and a hydrographic chart (water depth). These parameters together with larvae data were then analyzed using RQ. Finally, spatial models were constructed within a GIS by combining the RQ models with digital map of environmental parameters. The results show that the model was best explained by using only sea surface temperature. The highest larvae densities were predicted in a relatively broad distribution along with the shallow water regions (Toyoura and Sawara to Yakumo) and the deeper water areas (center of the bay). The spatial model built from the RQ provided robust estimation of the scallop larvae distributions in the study area, as confirmed by model validation using independent data. These findings could contribute on the monitoring program in this region in order to distinguish the potential areas for an effective spat collection.
, Masahiro Yasuda
Indonesian Aquaculture Journal, Volume 6, pp 165-171; https://doi.org/10.15578/iaj.6.2.2011.165-171

Abstract:
Koi herpesvirus (KHV), may cause significant morbidity and mortality in common carp (Cyprinus carpio). In the present study, an electron microscopic (EM) was performed on KHV-infected cultured koi fin (KF-1) to document the ultrastructure of the lesions. Viral particles were firstly evident in the nucleus. These viral particles observed as immature capsids and nucleocapsids. Many non-enveloped nucleocapsids have moved from the nucleus into the cell cytoplasm. The formation of subviral particles and virions, which comprised, in turn, an electron dense core, capsids with a hexagonal outline, the tegument was evident in the cytoplasm. And then, the virions with the enveloped tegument budded through the intracytoplasmic membrane. Based on EM results, the definitive pathological change was similar as those in the Family Herpesviridae.
, Kurniasih Kurniasih, Wisnu Nurcahyo, Triyanto Triyanto
Indonesian Aquaculture Journal, Volume 6, pp 31-36; https://doi.org/10.15578/iaj.6.1.2011.31-36

Abstract:
Arwana Irian fish is one of the endangered species. Some studies on arwana Irian fish found that Lernaeosis attacked arwana Irian fish. Lernaeosis is one of the diseases that cause the high mortality in juvenile fish. The objectives of this research was to find out the species of Lernaea (Copepoda) often attacked arwana Irian fish. Lernaea sp. was collected from Papua and Jakarta (Java). They were fixed in the ethanol absolute solution for DNA sequencing in 28S DNA region with primer 28SF (5’–ACA ACT GTG ATG CCC TTA G–3’); 28SR (5’ TGG TCC GTG TTT CAA GAC G–3’). It was found five different species of Lernaea and one of them was thought as a new species, based on the morphology. However, based on the phylogenetic analysis, they showed three different groups. Lernaea cyprinacea G., L. papuensis, L. devastatrix, and L. lophiara were in one group; L. cyprinacaea and L. oryzophila were in one groups; and the new Lernaea sp. was in the different group.
, Emma Suryati, Arifuddin Tompo
Indonesian Aquaculture Journal, Volume 5, pp 53-59; https://doi.org/10.15578/iaj.5.1.2010.53-59

Abstract:
Blue shrimp disease is one of the main problems in tiger shrimp culture. It reduces shrimp quality which eventually will decrease its market price. Blue shrimp is caused by deficiency of nutrition and additive materials such as carotene and other nutrient which function as vitamin source for important metabolic processes and formation of color profile in shrimp and fish. The aims of this study were to study the application effect of carotenoid extract of sponge Callyspongia basilana, as an additive material on the ability of shrimp to get back to normal state after suffering blue shrimp disease and survival rate of shrimp and to find out the optimal concentration of sponge carotenoid extract to cure the diseased shrimp. This study was consisted of two steps namely; (1). Extraction of sponge carotenoid by maseration and fractionation using acetone and petroleum ether solvents and (2), the application of carotenoid extract on the diseased shrimp. The research was arranged in a complete randomized design with four experiments consisted of (A). Control (without carotenoid extract); (B),(C), and (D) carotetoid extract addition of 3 mg/L, 6 mg/L, and 9 mg/L respectively with three replication each. The test animal used were blue diseased tiger shrimp with the density of 15 ind./container having 7.5–9.5 cm in size and the average weight of 5.5–10.0 g. The study showed that Callyspongia basilana carotenoid extract was able to change blue diseased shrimp to be normal within six days at the concentration of 9 mg/L. The highest survival rate was found in the experiment D (93.3%). Meanwhile, the lowest was obtained by the control population (13.3%) and the other two treatments were 80.0%(C) and 73.3% (B). The average of water quality parameters such as temperature, dissolved oxygen, pH, salinity, nitrite, and ammonia were in the suitable range for the growth and survival rate of tiger shrimp.
, Usman Usman, Rachman Syah
Indonesian Aquaculture Journal, Volume 9, pp 123-132; https://doi.org/10.15578/iaj.9.2.2014.123-132

Abstract:
The purpose of this experiment was to evaluate the effects of using seaworm meal in artificial diet as partial substitution of freshfeed for maturation of tiger shrimp. This experiment started by growing-out tiger shrimp with initial weight around 60 g for four months until reaching maturation phase where shrimp weight were over 90 g for female. Tiger shrimp was selected and stocked into 10 ton concrete tank with stocking density of 50 shrimps with ratio of female : male of 1:1. Dietary treatments were different levels of seaworm meal at 0% (SW0), 10% (SW10) and 20% (SW20). SW0 was positive control without seaworm meal but breeder was fed with frozen seaworm. Test diets were fed as a combination of 60% test pellet and 40% fresh feed. Artificial insemination was carried out for all females before ablation to obtain fertile eggs. Results showed that after ablation, number of female matured was highest in group fed SW10 (13 breeders) and the lowest in female fed control group (7 breeders). Number of female spawned was also highest in female fed SW10 and the lowest was in positive control. Fecundity was very low in all treatments ranged from 12,000-79,700 eggs/spawn. Even though female bearing spermatophore through insemination, number of spawning hatched was very low, only three spawned in each of SW0 and SW10 and two spawned in SW20. Based on number of breeders matured and spawning rate, breeder fed with SW10 gave better performance than other two diets. Technique of artificial insemination needs to be improved to increase the number of fertile eggs.
, Jadmiko Darmawan, Raden Roro Sri Pudji Sinarni Dewi, Wahyu Pamungkas,
Indonesian Aquaculture Journal, Volume 9, pp 9-14; https://doi.org/10.15578/iaj.9.1.2014.9-14

Abstract:
The success of spawning is influenced by internal and external factors. One of the factors that affect the var iabi li ty of Pangasianodon hypophthalmus female reproductive is the change of seasons that cause disrupted continuity of the seed availability, especially in the dry season. In the present study, combination of PMSG (pregnant mare serum gonadotropin) + HCG (hormone chorionic gonadotropin) hormone injections was done to induce gonad development. The treatments in this study were without hormone injections as control (A), injection of PMSG 10 IU/kg + HCG 10 IU/kg (B), and injection of PMSG 20 IU/kg HCG + 10 IU/kg (C). Injections were conducted at intervals of two weeks as many as six times. The results showed that gonad maturation generally occurs 2-4 weeks after estradiol-17 peak. PMSG + HCG hormone injections gave a significant effect on increasing the quantity and quality of eggs production. The fecundity in the A, B, C treatments, were 233,700±220,676; 300,305±24,581 and 488,433±142,228; respectively. Number of larvae produced from the A, B, C treatments, were 156,979±170,838; 229,997±18,081 and 362,713±101,850; respectively. Combination of PMSG 20 IU/kg + HCG 10 IU/kg hormone injection gave the best result on fecundity and the number of larvae production.
, Teruo Miyazaki
Indonesian Aquaculture Journal, Volume 9, pp 147-154; https://doi.org/10.15578/iaj.9.2.2014.147-154

Abstract:
Red seabream iridovirus (RSIV) has been known to induce enlarged cells and inclusion body bearing cells (IBCs) allowing virus particles to propagate within viral assembly site (VAS) in the cell cytoplasm. The aim of this study was to evaluate fine structural analysis of unproductive and low-productive cells resulting on RSIV-infected cultured grunt fin (GF) cells. GF cells were treated with semi purified RSIV, and incubated for 6-14 days post cultured. The cellular enlargement were harvested, processed, and analysis under electron microscopy. Electron microscopy revealed four types of cells that were productive enlarged cells and productive IBCs which were allowing propagation of virus particles within its cytoplasm, and unproductive enlarged cells and IBCs without virus particles. Most of them were unproductive enlarged cells (80,71%-98,20%). Unproductive enlarged cell had a nucleus with enlarged cytoplasm without production of VAS with virus propagation. While, unproductive IBC had an inclusion body that was delimited from the host-cell cytoplasm by a thin membranous boundary, and was developed without virus propagation. On the other hand, lowproductive enlarged cells and IBCs contained a few number of virus particles or tubule-like structures. Therefore, the number of low-productive enlarged cells and IBCs were only a few (about 0%-14% from a total of percent productive enlarged cells and IBCs), these cells were classified into types of productive enlarged cells and IBCs. These results sugested that the unproductive and low-productive enlarged cells and IBCs were the results of RSIV-infected GF cells which failed to produce virus particles due to incapacity of RSIV virus it self and or the ability of GF cells to inhibit virus multiplication within VAS.
Lili Sholichah, Angela Mariana Lusiastuti, Domenico Caruso, I Wayan Subamia, Uni Purwaningsih
Indonesian Aquaculture Journal, Volume 5, pp 139-145; https://doi.org/10.15578/iaj.5.2.2010.139-145

Abstract:
A case study of tumour in koi carp (Cyprinus carpio) was observed in rearing periode. This tumour occurs solitary, large, pale red, fleshy masses under the lips and dental plates on the outside, and by reason of its size, may prevent closure the mouth. Moreover, this tumour goes through into the inside of the mouth. At necropsy, there were two soft, firm, small mass at inside of the mouth and the bigger mass at outside the mouth. Samples of this tumour were fixed in 10% formalin were used for histology analysis. The clinical course of the tumour is one of relatively slow but progressive growth. The proliferative stage of the neoplastic process is preceded and accompanied by a striking vascular reaction. Intensed hyperemia invariably occurs in that region of the mucosal surface which later becomes the site of neoplastic proliferation. Neoplastic cells lied around lamina propria and submucosal. These cells were joined together to make vacuolization and the other cells become pleiomorphism with hyperchromatic nucleus and N/C ratio cells are 1:1. In some area, there were many empty holes, around the holes there were debris cells, inflammation cells, and erythrocytes.
, Ketut Suwirya, Muhammad Marzuqi, Ni Wayan Widya Astuti
Indonesian Aquaculture Journal, Volume 4, pp 33-40; https://doi.org/10.15578/iaj.4.1.2009.33-40

Abstract:
Red snapper, Lutjanus sebae is favored in mariculture activities because it has a relatively good market and price. Technology for big scale seed production of this species has been developed and is now adequate to supply seed for grow-out activities. However, the availability of artifical diets for L. sebae is still a major constraint for grow-out production. Data on optimum dietary protein and lipid requirements for this fish as a basic information in feed development is not available yet. The objective of the present study was to find out dietary protein and lipid requirements for juvenile of L. sebae. A 70-day feeding experiment was conducted in 24 fiberglass tanks, 200 L volume. Each tank was equipped with a flow-through water system. Twenty five hatchery-produced juveniles of L. sebae (43.1 g BW) were randomly selected and stocked in each tank. The fish were fed with the experimental diets twice everyday at a level of 3% of biomass for the first 4 weeks, and then 2% of biomass afterward. Twelve experimental diets were prepared in form of dry pellet containing casein and fish meal as the main protein sources. Experimental diet had 4 levels of crude protein (32%, 37%, 42%, and 47%) and each protein level consisted of 3 levels of lipid (7%, 12%, and 17%). The experiment employed factorial method with completely random design using 12 combination treatments and 2 replications for each treatment. Result of the experiment showed that there was no significant effect of dietary protein and lipid on growth, feed consumption, and feed efficiency of tested fish. Growth and feed efficiency of fish fed on diet containing 42% and 47% crude protein were significantly higher than that of fish fed on diet containing 32% and 37% crude protein. High lipid content in the diet (17%) resulted in poor growth and poor feed efficiency. This data indicates that Lutjanus sebae has limited ability to utilize dietary lipid as an energy source. Result of the present study recommends that dietary protein and lipid requirement for good growth of L. sebae should be 42% and 12%, respectively.
Coco Kokarkin Soetrisno
Indonesian Aquaculture Journal, Volume 4, pp 109-119; https://doi.org/10.15578/iaj.4.2.2009.109-119

Abstract:
White spot syndrome virus is recognized as the most prominent pathogen of penaeid shrimp and has been affecting this shrimp farming industry around the world. The virus may reduce the shrimp’s immune response and alter enzymatic and biochemical composition of tissues. Similar to other environmental stressed or other pathogeninfected shrimp, in late stages of WSSV infection, shrimp will fail to clot the haemolymph, so any minor injury will lead to increased haemolyph loss. A series of experiments to determine the effect of non-clotting haemolymph on WSSV infection were carried out in controlled facilities in Indonesia. The preliminary test showed that normal clotting time was 13.3 seconds while WSSV-injected shrimp mostly failed to clot their haemolymph 16 hours post infection (hpi). Some other clinical signs such as abnormal swimming, red discoloration, white spots and mortality were consistent with those observed by previous studies. Three shrimp species: banana shrimp (P. merguiensis) 9 g , white leg shrimp (P. vannamei) 7 g and the tiger shrimp (P. monodon) 16.5 g were water-borne-challenged with non-clotting, WSSV-infected haemolymph (NCH) from tiger shrimp donor in duplicate tanks each with 12 shrimp. The control were tiger shrimps fed with WSSV-infected tissue at the rate of 40% of bodyweight (BW) and other tiger shrimps were used as negative controls fed with commercial feed only.The study revealed that NCH dosages of 1.46%; 2.03%; and 2.06% (v/v) for eachspecies were sufficient to infect and kill all shrimps in less than two days comparedto eight days for the shrimps fed on infected tissue. The WSSV in non-clottedhaemolymph eventuallyattaches into the living tissues of healthy shrimp. This modeof infection is likely more difficult to control by the ordinary fine mesh screeningmethod.
I Wayan Subamia, Media Fitri Isma Nugraha, Slamet Sugito
Indonesian Aquaculture Journal, Volume 3, pp 119-124; https://doi.org/10.15578/iaj.3.2.2008.119-124

Abstract:
The purpose of these observations was to identify the stages of the embryo development of ikan palmas (Polypterus senegalus senegalus) and determine the length of duration of each stage. Broodstocks were cultured in aquaria 6 cm x 72 cm x 50 cm in size. The broodstock were stocked at ratio of 1:1 and fed ad libitum with earthworm, small feed fish (ting sea fish) and golden snail. The Palmas broodstocks here naturally spawned in artificial nests made of split plastic raffia in resembling the aquatic plant found in the natural habitat of ikan palmas. After 21 days of culture period, the broodstock began to lay eggs in gradually for 20 days. The average diameter of the eggs was 25 μm. The embryo developed in 24 hours after fertilization and hatched out three days after the embryo had developed.
Taukhid Taukhid, Yani Lestari Nur’Aini
Indonesian Aquaculture Journal, Volume 3, pp 139-146; https://doi.org/10.15578/iaj.3.2.2008.139-146

Abstract:
The aquaculture industry in Indonesia has been growing rapidly and plays an important role in rural development and export earning. Penaeid shrimp culture in Indonesia has become a leading export earning in fisheries sector. The main constraint encountered with shrimp culture has always been associated with disease outbreaks, especially, caused by viral agents. The Pacific white shrimp (Litopenaeus vannamei) was unofficially introduced to Indonesia in 1999, and officially approved by Indonesian government in 2001. By the end of 2007, the Pacific white shrimp has been cultured in more than 17 provinces. The Taura Syndrome (TS) disease was detected in Indonesia in 2002, and the disease is currently found in at least 10 provinces. The Infectious Myonecrosis (IMN) is an emerging disease for L. vannamei in Indonesia, first detected in May-June 2006, causing significant mortalities in grow-out ponds. The IMN is characterized by an acute onset of gross signs: focal to extensive whitish necrotic areas in the striated muscle, especially on the distal abdominal segments and tail fan. White necrotic areas become reddened similar to the color of cooked shrimp. The outbreak resulted in elevated mortalities was initially associated with a chronic course of persistent low level mortalities. Up to date, IMN was detected in East Java, Bali, and West Nusa Tenggara provinces. This paper is a brief review of the epidemiological study of IMN disease of Pacific white shrimp in Indonesia: the status of outbreaks, surveillance, and disease diagnosis, and control measures.
, Ahmad Muzaki, I Gusti Ngurah Permana, Haryanti Haryanti
Indonesian Aquaculture Journal, Volume 9, pp 97-102; https://doi.org/10.15578/iaj.9.2.2014.97-102

Abstract:
Fluctuating asymmetry has been widely used as a measure of developmental stability and as an indicator of individual fish growth. The present study compared fluctuating asymmetry in three bilateral meristic traits of F-1 hybrid between female Epinephelus fuscoguttatus and male Epinephelus polyphekadion and two F-1 pure parental progenies. The fishes were reared by communal and separate tank systems. Hybrids were confirmed by allozymes electrophoresis. After three months of rearing, the F-1 hybrids fish grew faster 45.9% and 66.6% compare to the F-1 pure parental progenies of E. fuscoguttatus and E. polyphekadion (P
, Rachman Syah, Muslimin Muslimin
Indonesian Aquaculture Journal, Volume 10, pp 57-63; https://doi.org/10.15578/iaj.10.1.2015.57-63

Abstract:
The use of organic mineral (OM) has been recently introduced in aquaculture both as feed supplement and water quality improvement. A feeding experiment was conducted to evaluate a response dose of OM on growth, survival, and mineral content in whole the body and carapace of vannamei shrimp (Penaeus vannamei). Three diets were supplemented with different levels of organic mineral at 1 (OM1), 2 (OM2) and 4 (OM4) g/100 g diet. Positive control was a diet without OM inclusion but supplemented with commercial mineral mixture at level of 4 g/100 g diet. Juvenile vannamei shrimp with average initial body weight of 3.5±0.1 g were stocked into 12 tanks with a capacity of 200 L. After 75 days feeding trial, highly significant weight gains was observed in shrimp fed OM at all levels compared to the positive control. However, no significant differences were found among dietary OM groups. The growth response was clearly shown by the same values of SGRs in the three OM supplemented groups (1.1%/d) and only differed significantly from positive control. Increasing of dietary OM significantly improved survival rate of shrimp where the highest was observed in group fed OM1 and the lowest was in control diet. Effect of dietary OM on whole body Ca and P were quite similar while whole body Ca and P content of OM1 group was slightly high and tended to decrease in two groups with higher level dietary OM. However, no significant differences among the treatment groups. A clear response of supplementing OM in diet was detected on whole body Zn content. Increase of dietary OM resulted in an increase of Zn content in whole body. The effect was clearly shown when diet contained 2% and 4% OM. Carapace Ca content was highly significant when diet contained 2% OM. Similar to whole body Zn content, there was also a linear trend of response dose of dietary OM on carapace Zn content which the highest was found in dietary OM4. Based on growth, survival rate, and Zn content in whole body and carapace, dietary OM at 1 g/100 g diet can replace mineral mixture as mineral source in diet of vannamei shrimp.
, Taukhid Taukhid, Eni Kusrini, Wartono Hadie
Indonesian Aquaculture Journal, Volume 4, pp 87-92; https://doi.org/10.15578/iaj.4.2.2009.87-92

Abstract:
Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG and perform phylogenetic analysis based on DNA nucleotide sequence data. The sequencing of PCR products was performed at BPPT Puspiptek Serpong by using the respective PCR primers, Big Dye Terminator Chemistry and AmpliTaq-FS DNA polymerase. The sequencing reactions were run on the ABI Prism version 3103 – Avant Genetic Analyzer (USA) and the result was read by Sequence Navigator program (Applied Biosystem). Alignment multiple analysis was done based on the data from Genebank with BLASTN (http://blast.ncbi.nlm.nih.gov/blast.cgi) on the nucleotide level. Neighbor-joining phylogenetic trees were generated with Genetyx programme version 7 with UPGMA and MEGA software version 4.0. The result revealed that the isolates from brain, eye, and kidney of diseased Tilapia were infected by S. agalactiae and it has 99% similarity with Genebank. It has close relationship with S. agalactiae at genebank with UPGMA method. These isolates showed high variation in the first sequence which is similar to S. iniae. The information of S. agalactiae genomes suggests that gene acquisition, duplication, and reassortment have played an important role in genetic diversity and evolution of S. agalactiae. Screening of breeder fish stocks with the developed PCR methodology, followed by elimination of infected stocks, would provide an efficient strategy to control fish infected by streptococcosis.
, Dedi Jusadi, Nur Bambang Priyo Utomo
Indonesian Aquaculture Journal, Volume 6, pp 149-156; https://doi.org/10.15578/iaj.6.2.2011.149-156

Abstract:
Two experiments were conducted to evaluate the hydrolysis of fiber content in palm kernel meal (PKM) by sheep rumen liquor enzyme and to know the apparent digestibility coefficient of hydrolyzed PKM for catfish Pangasius hypophthalmus. The first trial examined effectivity of sheep rumen liquor enzyme to decrease crude fiber content of PKM. The added volume of sheep rumen liquor enzyme was 0, 20, 40, 60, 80, and 100 mL/kg PKM and then it was incubated for 0, 12, and 24 hours. A factorial completely randomized experimental design consisted of 2 variables and triplicates were selected. The second trial was conducted to evaluate the apparent digestibility coefficients of hydrolized PKM for catfish. Apparent digestibility coefficients were determined using chromic oxide indicator added to both reference and test diets. The feed ingredients used in the trial were hydrolyzed PKM (PKMe) and unhydrolyzed PKM (PKM). Ten fishes with weighing around 20 g were used in the trial and held in 80 l tanks. Feces were collected from three replicate groups of fish using a fecal collection column attached to fish rearing tank. PKM hydrolyzed with 100 mL/kg and incubated for 24 hour showed the lowest crude fiber content (6.99%) among the treatments (P
Imron Imron
Indonesian Aquaculture Journal, Volume 4, pp 25-31; https://doi.org/10.15578/iaj.4.1.2009.25-31

Abstract:
Inbreeding depression has often been considered to be responsible for the deterioration of performance in aquaculture species. Despite a crucial impact that may result from inbreeding depression, comprehensive information reviewing this subject is limited. This study was aimed to gain information on the effect of inbreeding on the early performance of freshwater prawn. The study was performed by comparing performance of inbred and outbred populations. Inbred population was established by brother-sister mating (inbreeding rate of 25%) while the outbred population was formed by mating unrelated individuals. Several fitness and productivity related traits including survival, the rate of larval development, stage dispersion and growth of larvae were evaluated. Results suggest that inbred families performed poorer than that of the outbred in survival. However, inbreeding depression did not seem to occur in other traits including the rate of larval development, larval stage dispersion and growth. This study implies that to maintain genetic quality of farmed prawn stocks, inbreeding rate in farmed population must be controlled not to exceed that level. Implications that these findings may have on aquaculture practices and possible alternatives for the solutions are discussed.
Page of 5
Articles per Page
by
Show export options
  Select all
Back to Top Top